sample.fas 699 Bytes
>Telomeric repeat-containing RNA (TERRA)
UUAGGGUUAGGGUUAGGGUUAGGGUUAGGGUUAGGGUUAGGGUUAGGG
>NM_000633 chr18:63318709-63318733
GGGGGCCGUGGGGUGGGAGCUGGGG
>hg38_refGene_NM_002524.4 range=chr1:114716863-114716883 5'pad=0 3'pad=0 strand=- repeatMasking=none
UGUGGGAGGGGCGGGUCUGGG
>ENST00000265340 chr5:135028038:135028073:-1
AGCGGGCAGUGCGGGCCUGGCGGGAGGUGGGGGAGG
>Spinach aptamer (false negative example)
GGACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUGU
UGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC
>String of U (T are internally converted to U)
UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
>String of C (sequences are case insensitive)
cccccccccccccccccCCCCCCCCCCCCCCCCCCCCCCCCCCccccccccccccccccc